Praveen, Kumar and Sabu, Thomas (2011) Presence of qnrVC3 gene cassette in SXT and class 1 integrons of Vibrio cholerae. International journal of antimicrobial agents, 37 (3). pp. 280-281. ISSN 1872-7913

Preview

Text Presence of qnr( Intl Jnl of Antimicrobial Agnts).pdf Download (60Kb) | Preview

Abstract

Sir, The toxigenic strains of Vibrio cholerae serogroups O1 and O139 are responsible for epidemic cholera, however other serogroups, collectively referred to as ‘non-O1/non-O139’, are also clearly pathogenic and have caused outbreaks or sporadic cases of diarrhoea in humans [1]. Recently, three novel qnr genes, named qnrVC1, qnrVC2 and qnrVC3, have been reported from V. cholerae O1 strains isolated from Brazil and Bangladesh, respectively [2], [3]. However, no information is presently available regarding the prevalence of qnr genes in V. cholerae from India. In the current investigation, the presence of qnrVC3 was analysed from O1 and non-O1/non-O139 strains isolated from Southern Kerala, India. Antimicrobial susceptibility testing was performed using commercially available disks (Himedia, Mumbai, India). The minimum inhibitory concentration (MIC) of ciprofloxacin was determined by Etest (AB BIODISK, Solna, Sweden). Detection of class 1 integrons and the SXT element was carried out by polymerase chain reaction (PCR). For confirmation of the presence of qnrVC3 in SXT, two pairs of primers were designed. PCR with rumB-F (GCAACCATTCTGCCGCATG) and qnr-R (CAAACCTCCGAGATACAC) yielded an amplicon of ca. 9 kb, and dfr-F (GGTACGTGTAATCAATATTTG) and tnp-R (CAGATCTTTATTCCCCACC) yielded an amplicon of ca. 2 kb. Sequencing of class 1 integrons and SXT (partial sequencing) was performed using an ABI PRISM® BigDye® Terminator Kit with an ABI PRISM® 3100 DNA Sequencer (Applied Biosystems, Foster City, CA). For dot–blot assay, plasmid and genomic DNA was spotted onto a nylon membrane (GE Healthcare, Piscataway, NJ), denatured and fixed by ultraviolet cross-linking, hybridised with biotin-labelled probe and detected using a Biotin Chromogenic Detection Kit (Fermentas, Burlington, Ontario, Canada) according to the manufacturer's instructions. The non-O1/non-O139 strains showed the presence of class 1 integrons, whereas O1 strains possessed the SXT element. Strains DRV184 and DRV228 possessed two different class 1 integrons. Sequencing of the 1.2 kb amplicon revealed dfrA1 and orfC (unknown function) gene cassettes, whereas sequencing of the 3.4 kb amplicon revealed the presence of arr3, qnrVC3, blaOXA-10 and aadA1 gene cassettes (GenBank accession no. HM015626). Sequencing of the 2.7 kb amplicon from strains DRV181 and DRV229 revealed the presence of qnrVC3, blaOXA-10 and aadA1 gene cassettes (GenBank accession no. HM015625). To our knowledge, these are novel qnrVC3-associated class 1 integrons reported from V. cholerae to date. All non-O1/non-O139 test strains showed the presence of 7 kb plasmids. Results of the dot–blot assay indicated the chromosomal location of class 1 integrons in all strains investigated. Partial sequencing of the 9 kb amplicon (rumB-F and qnr-R primers) and the 2 kb amplicon (dfr-F and tnp-R primers) confirmed the presence of dfr6 and qnrVC3 gene cassettes in SXT of V. cholerae O1 strains (GenBank accession no. HM015627). The ciprofloxacin MIC was 0.25 μg/mL in non-O1/non-O139 strains in contrast to MICs of 0.75 μg/mL and 2 μg/mL in MCV09 and A880, respectively (Table 1). Compared with the MIC of a susceptible strain (VC20), it could be inferred that strains possessing qnrVC3 exhibit low-level resistance to ciprofloxacin. Moreover, mutations in gyrA (Ser83 → Ile) and parC (Ser85 → Leu) were detected, which may be responsible for the high MIC in O1 strains rather than the presence of qnrVC3 alone.

Item Type:	Article
Subjects:	Cholera And Biofilm Environmental Biology
Depositing User:	Mr. Shibin S B
Date Deposited:	02 Aug 2018 04:58
Last Modified:	02 Aug 2018 04:58
URI:	http://rgcb.sciencecentral.in/id/eprint/676

Actions (login required)

View Item